Deletion | NM_007294.4(BRCA1):c.5304del (p.Tyr1769fs) | BRCA1 | Pathogenic | 17 | 41203108 | 41203108 | AG | A | reviewed by expert panel | Breast Cancer Information Core (BIC) (BRCA1):5423&base_change=del C,ClinGen:CA003457 |
Deletion | NM_007294.4(BRCA1):c.5311_5332+1del | BRCA1 | Pathogenic | 17 | 41203079 | 41203101 | ACCTGTGGGCATGTTGGTGAAGGG | A | criteria provided, single submitter | Breast Cancer Information Core (BIC) (BRCA1):5430&base_change=del 23,ClinGen:CA10602574 |
single nucleotide variant | NM_007294.4(BRCA1):c.5332+2T>A | BRCA1 | Pathogenic/Likely pathogenic | 17 | 41203078 | 41203078 | A | T | criteria provided, multiple submitters, no conflicts | Breast Cancer Information Core (BIC) (BRCA1):5451+2&base_change=T to A,ClinGen:CA003487 |
Duplication | NM_007294.4(BRCA1):c.5352dup (p.Gln1785fs) | BRCA1 | Pathogenic | 17 | 41201191 | 41201192 | G | GT | reviewed by expert panel | Breast Cancer Information Core (BIC) (BRCA1):5471&base_change=ins A,ClinGen:CA003518 |
Deletion | NM_007294.4(BRCA1):c.5370_5397del (p.Val1791fs) | BRCA1 | Pathogenic | 17 | 41201147 | 41201174 | GGGTGAATGATGAAAGCTCCTTCACCACA | G | reviewed by expert panel | Breast Cancer Information Core (BIC) (BRCA1):5489&base_change=del 28,ClinGen:CA003538 |
Deletion | NM_007294.4(BRCA1):c.5406+2del | BRCA1 | Pathogenic | 17 | 41201136 | 41201136 | TA | T | criteria provided, single submitter | Breast Cancer Information Core (BIC) (BRCA1):5525+2&base_change=del T,ClinGen:CA268394 |
single nucleotide variant | NM_007294.4(BRCA1):c.5407-1G>A | BRCA1 | Pathogenic | 17 | 41199721 | 41199721 | C | T | criteria provided, multiple submitters, no conflicts | Breast Cancer Information Core (BIC) (BRCA1):5526-1&base_change=G to A,ClinGen:CA003569 |
single nucleotide variant | NM_007294.4(BRCA1):c.5407-1G>C | BRCA1 | Pathogenic/Likely pathogenic | 17 | 41199721 | 41199721 | C | G | criteria provided, multiple submitters, no conflicts | Breast Cancer Information Core (BIC) (BRCA1):5526-1&base_change=G to C,ClinGen:CA003570 |
Insertion | NM_007294.4(BRCA1):c.5464_5465insT (p.His1822fs) | BRCA1 | Pathogenic | 17 | 41199662 | 41199663 | T | TA | reviewed by expert panel | ClinGen:CA003609 |
single nucleotide variant | NM_007294.4(BRCA1):c.5467+2T>C | BRCA1 | Pathogenic/Likely pathogenic | 17 | 41199658 | 41199658 | A | G | criteria provided, multiple submitters, no conflicts | Breast Cancer Information Core (BIC) (BRCA1):5586+2&base_change=T to C,ClinGen:CA003611 |